(Solved): The hnRNA transcript [or primary transcript or Pre-mRNA] of Eukaryotes has removed and the remainin ...

The hnRNA transcript [or primary transcript or Pre-mRNA] of Eukaryotes has removed and the remaining are joined by binding snRNPs in splicesome regions or by the RNA itself [ribozymes]. This mRNA has a on the \( 5^{\prime} \) end and a on the end. All three RNAs complex together to form the Translocation initiation complex. The enzyme activated tRNA with methionine and the 5' end of the mRNA binds to the small ribosome unit with the assistance of protein binding and the large unit binds with the tRNA in the " \( \mathrm{T} \) " site. This process has taken GTPs as an energy cost of the initiation complex. Now, another tRNA that has anti-codon sequences matching RNA codons associated with the \( \mathrm{A} \)-site will successfully position in the ribosome with the assistance of \( \mathrm{BF} \). _ and at the peptidyl-transferase center between the amino acids attached to the adjacent tRNAs, a bond is formed between the amino- and the acid groups of the amino acids and then the P-site tRNA is freed from the amino acid. Now, another protein, \( \mathrm{BF} \) - - binds to the ribosome and moves the RNA one codon towards the E-site and the tRNA is released from the ribosome complex. Now, the A-Site is available to repeat the cycle. It has taken more GTPs for these two steps - amino attachment to tRNA and then the step of moving the ribosome. Lastly, as the process continues, if the codon does not match with any anti-codons, a factor binds and with the help of GTP [s], releases the ribosome complex and the produced protein. Once the protein is produced, it can be folded by itself or by a protein, but some proteins may need to be further Therefore, if this process produced the below chain of amino acids, how many total GTPs were utilized? If the DNA base sequence is the following: TACCCGTTATTCGGTGTGTGAATT What is the amino acid sequence?