(Solved): Examine the DNA RFLP analysis shown below. Compare the three sample digestions (A, B, and C) to the ...

Examine the DNA RFLP analysis shown below. Compare the three sample digestions $(A,B$, and $C)$ to the Reference sample (Ref). Which sample matches the reference? $?$ Open in Reading View ATG $A$ ATTCGTG $?AATTCTCGCATTGTG$ AATTCTGTGTGATAAGACGAATTCTTAGTAG $?A$ ATTCG TACTTAA GCACTTAAGAGCGTAACACTTAAGACACACTATTCTGCTTAAGAATCATCTTAAGC A B C D E F Figure 10.4: Sample RFLP Analysis Homework - Unanswered - Due Today, 11:59 PM An RFLP analysis was performed on the sequence of DNA (see Figure 10.4). Cut sites are indicated in red, DNA fragments are labeled alphabetically from left to right in blue. Compare the two possible patterns of fragment movement during gel electrophoresis shown in Gel \#1 and Gel $\$2$. Which of these banding patterns matches the actual digest shown on the sequence? Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answet. a Gel \#1 b Gel \#2 c Neither gel matches