Home /
Expert Answers /
Biology /
below-is-the-sequence-of-a-complete-mrna-from-a-bacterial-cell-5-39-acuagcaggagacguaagcgaugugccagaug-pa424
(Solved): Below is the sequence of a complete mRNA from a bacterial cell: 5' ACUAGCAGGAGACGUAAGCGAUGUGCCAGAUG ...
Below is the sequence of a complete mRNA from a bacterial cell: 5' ACUAGCAGGAGACGUAAGCGAUGUGCCAGAUGCGCAGUCACACAUAACUGCAA 3' How many amino acids long is the protein? [2 points] What will be the sequence of amino acids in the protein? [3 points] If the underlined base changed from A to G, what would be the effect on the protein? [2 points] If the underlined base changed from A to U, what would be the effect on the protein? [ 3 points]
The given mRNA sequence is a string of nucleotides that code for a protein. To determine the amino acid sequence of the protein, we need to translate the mRNA sequence into its corresponding amino acid sequence. This process is called translation and it involves reading the mRNA sequence in groups of three nucleotides (codons) and using the genetic code to convert each codon into a specific amino acid.Step 1:Divide the mRNA sequence into codons of three nucleotides each: 5' ACU AGC AGG AGA CGU AAG CGA AUG UGC CAG AUG CGC AGU CAC ACA UAA CUG CAA 3' Thr Ser Arg Arg Arg Lys Arg Met Cys Gln Met Arg Ser His Thr Asn Leu Gln
To do this, you simply group the nucleotides in sets of three, starting from the first nucleotide. The resulting codons can be read off the table in a genetic code chart to determine the corresponding amino acid.