Home /
Expert Answers /
Biology /
10-a-mutation-identified-in-one-base-pair-of-the-gene-causes-it-to-be-less-active-caaggcatgccgac-pa700
(Solved): 10. A mutation identified in one base pair of the gene causes it to be less active. CAAGGCATGCCGAC ...
10. A mutation identified in one base pair of the gene causes it to be less active. CAAGGCATGCCGACCTATCGGCCATAATAACC 3 ' Normal CAAGGCATGCCGGACGATCGGCCATAATAACC 3' Mutated e sequence above is DNA. (4 points) a. What is the complimentary DNA strand (be sure to include direction)? b. What is the mRNA strand? Use your DNA strand as the template c. What is the amino acid sequence? (see codon chart at end of worksheet) d. What is the result of a mutation shown in yellow and underlined? (Name of mutation and any changes to the amino acid.)